maruiqi0710
maruiqi0710
I am annotating the fungal genome. Can the RNA fasta files from the same family in NCBI's Refseq be combined (redundant data) and then provided to the "funannotate predict --transcript_evidence"...
If I need to annotate many assemblies of the same species, do I need to train them one by one? Can I reuse previous training results? In other words, if...
I got lots of InterProScan annotation files with an XML suffix through iprscan5.py (Script from https://www.ebi.ac.uk/seqdb/confluence/display/JDSAT/InterProScan+5+Help+and+Documentation). How to merge them into one file and then pass it to funannotate annotate...
I want to annotate the genome of a yeast. I do not have RNA data for the genome which I want to annotate, but there are RNA SRA data for...
Can this software now check the sequencing contamination of fungi and other Eukaryote? Do I have to use BlobToolKit rather than BlobTools to check contamination of fungi and other Eukaryote?
I need to detect the source of paired reads for a batch of sequencing data, and each time I need to reload the database into memory, the loading speed is...
Do I need to run LD Prune before running Dsuite?
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)? Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse filter: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
I donwload nt from ftp.ncbi.nlm.nih.gov:/blast/db/FASTA/nt.gz. Then, make db using: > makeblastdb -in ./nt -dbtype nucl -out ./nt_blast_db Then, run > "$blastdbcmd" -db "$db" -entry all -outfmt "%a %T" > "$taxidmapping"...
Can HGTector2 detect HGTs from the 'Close' group to the 'self' group?