fcs icon indicating copy to clipboard operation
fcs copied to clipboard

Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor?

Open maruiqi0710 opened this issue 2 years ago • 2 comments

Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)? Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse filter: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG

maruiqi0710 avatar Sep 22 '23 10:09 maruiqi0710

Hello,

The exact set of adaptors isn't documented yet, but you can look at sequences with 'gnl|uv|NGB' prefixes at https://www.ncbi.nlm.nih.gov/tools/vecscreen/uvcurrent/ to get a sense of what's included, and then search the page if you're looking for something specific. In summary, it's in large part various flavors of Illumina, some older sequencing technologies (e.g. ABI SOLiD, 454), and a couple PacBio. We will soon have a new update with more Illumina, as well as some PacBio and Nanopore adaptors.

We do not currently have any BGI sequencing adaptors, and I did a search of the sequences you posted above and there are not any shared subsequences with our current database entries that would trigger reporting by FCS-adaptor. So these would indeed be candidates for adding to a future database release.

Can you post an online resource for these sequences, or the exact kit name you used? We would have to do some internal testing before including these sequences in a database release, so if this needs a quick turnaround I would suggest an alternative solution.

Another potential solution is modifying FCS-adaptor code to allow a user to submit a custom set of adaptors which then gets appended to the standard database and then conducts a search. We would need to identify additional user interest to pursue that solution.

Eric

etvedte avatar Sep 22 '23 17:09 etvedte

These sequencing adapters can be found in (https://en.mgi-tech.com/download/files?q=adapter) . The document titled "【User Manual】DNBSEQ Dual Barcode Adapter & Barcode Sequences A1" provides access to these adapters on the aforementioned website. When using Google to search for the above-mentioned sequences, they were found to have been mentioned in some academic articles.

maruiqi0710 avatar Sep 23 '23 12:09 maruiqi0710