tkcaccia

Results 10 comments of tkcaccia

Hi sfchen, I am in the same situation. I do not find genefusion in the test dataset.

The output of the somatic folder is here below. I will try now to run for chr1... ``` total 1112440 -rw-rw-r-- 1 user user 153712 Dec 16 18:48 chr10.cell_snv.cellID.csv -rw-rw-r--...

While the program is running, I am not sure that the csv file is optimal. Could be the id column with too low values? ``` cell id AAAAAAAAGCTT 477 AAAAAATTCTTT...

The program has like this: ``` python ${path}/src/Monopogen.py somatic \ -a ${path}/apps \ -r /media/user/Data/single-cell/20240910-B164/input/region1.lst \ -i /media/user/Data/single-cell/20240910-B164/output/G0157 \ -l /media/user/Data/single-cell/20240910-B164/input/G0157.csv -s cellScan \ -g /media/user/Data/Resources/GRCh38UCSF/hg38.fa [2024-12-17 17:21:58,736] INFO Monopogen.py...

Could it be related to the index program used for the reference genome?

My barcode in the BAM file looks very different ``` samtools view sorted.bam | less -S HGGFCDRX5:1:2215:20546:18004 16 1 10033 0 72M * 0 0 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACACTA FFFFFFF:FFFFFFFFFFFFFF> A01240:1004:HGGFCDRX5:1:2223:16812:8187 16 1...

I did not do my experiments with Chromium. I cannot use the Cell Ranger pipeline to extract my barcode

I have the same questions. I successfully created a spatial Seurat object but wondered if the function `CreateCentroids` can manage three-dimensional information (e.g., xyz). ``` seu

It sounds great. Thank you for your fast reply. Currently, spatialdata is at the version 0.2.1 Are we expecting the version 0.2.2?

Same issues. I don't have email .edu and I don't even receive a feedback