diego-rt

Results 40 comments of diego-rt

Yes I fully agree. I just ran cutadapt (`-g TTAACCGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTTTCGTGCGCCGCTTCA -a TGAAGCGGCGCACGAAAAACGCGAAAGCGTTTCACGATAAATGCGAAAACGGTTAA --error-rate 0.3 --overlap 30 -m 1000 `) on my ultra long data and after one round of 5'...

Hey guys, Sorry for my late reply. Just a heads up that for ultra long (and I assume also for other rapid adapter based library preps but I dont have...

I would try pore chopfirst and cutadapt second. Since porechop can split reads based on internal adapters and therefore deal with chimeric reads. You can then use cutadapt for a...

Sorry to jump in, but as a heavy user of giant genomes (30 Gbp and more), I think it is absolutely indispensable to have the `-I` option enabled.

Hi @chhylp123 No worries, thanks a lot for your reply as always! 1. Ok 2. I assumed that since you wrote that 37 was ideal for human, in a worst...

Hi, does this week's release already implement the change?

Ok, super! Thanks a lot!

Hey there, Sorry to bug you again 😅 Do you have any news on the memory consumption update?

Hi @chhylp123 Hope you are doing well and had a good start of the year! Do you by any chance have any updates on the memory consumption fix?

Actually, this leads to another question... At what heterozygosity rate would you consider a genome as inbred? Our species has been inbred for ~150 years but with a long generation...