IntaRNA icon indicating copy to clipboard operation
IntaRNA copied to clipboard

Efficient target prediction incorporating accessibility of interaction sites

Results 32 IntaRNA issues
Sort by recently updated
recently updated
newest added

sometimes only the multi-threading libs are installed, which causes linking to the standard libs (without `-mt` suffix) to die.. in that case we might need something like this ``` LIBS="$LIBS...

bug

``` --> IntaRNA -q AACCGUGGCUUUCGAUUGUUAC -t AACCGUGGCUUUCGAUUGUUAC -n 50 --outmode=C --outcsvcols=hybridDPfull,E,ED1,ED2,E_hybrid --outmaxE=-3 --noseed --outnolp # INFO : Since no seed constraint needed: resetting model from 'X' to 'S' hybridDPfull;E;ED1;ED2;E_hybrid ...........((((.......&...........)))).......;-3.7;0;0;-3.7...

bug

Hi, it is possible to make IntaRNA output two files (two different output setups) like one detailed RNA:RNA interaction file and one customizable CSV file? Or basically any combination of...

feature request

tackle user feedback: > The only aspect I think confused me was whether sub-optimal matches were talking only about the same position in the UTR/miRNA - with differences in binding...

.. to avoid that fasta files have to be pruned

- create a personality that takes an interaction and provides respective energy and seed assignments

student project

http://www.nupack.org/partition/info?melt=true&complexes_job=true&page_name=histogram_detail

- global mapping of small RNA interactome: http://www.cell.com/molecular-cell/pdf/S1097-2765(16)30413-0.pdf -ncRNA-mRNA interaction: shuffled controls consistently more stable than real interactions. http://www.slideshare.net/ppgardne/avoidance-of-stochastic-rna-interactions-can-be-harnessed-to-control-protein-expression-levels-in-bacteria-and-archaea - random RR interaction avoidance: https://elifesciences.org/content/5/e20686 https://elifesciences.org/content/5/e13479

one file output output of pairwise spotProb, mfe, etc. information per query or target - q|t defines column indices respectively - other sequence(s) define rows - additional (leading) column with...

- include RNAplex model - enable seed heuristic - enable nested + pseudoknot accessibilities

student project