whitleyo

Expected barcodes for 10X Chromium data

1

Hi, My input bam files come from a 10X Chromium experiment and have entries with format GTTCCTCCAAGTCGATGGCACCTCCCTCCCTCTCAACCACTTGAG DADBCHII?FGE?DCGGEG1@

cell barcodes missing in output after samtools sort by tag

2

**samtools version:** samtools 1.9 Using htslib 1.9 Copyright (C) 2018 Genome Research Ltd. **operating system:** I don't know which node my job was run on, but looking through my emails...

Failure to Capture Common Sources of Variance in Data

1

Hi, I've tried MOFA with several datatypes, some having ~50 samples while others have 15 or 22 samples. Here's an overview of the data:  RNA.vst = vst transformed RNA-seq...

Hi, I'm trying to run nmf with multiple ranks on a toy dataset with 2 2D gaussian clusters. Here's what I try running: ``` `require(apcluster) require(NMF) ### setup image output...