shengzha
shengzha
Many thanks for the great work! Just a minor question, isn't Truseq Index 1 sequencing primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC? Your current version has an extra leading A.
Is the issue fixed? I ran into the same error and after checking out GATK from GitHub and with the latest build (commit 031c40773d2aefd289005319d6880dbeb3c1dec9, gatk-4.1.4.1-83-g031c407-SNAPSHOT), the problem persisted.
@cmnbroad Thank you so much for the reply. I don't have a small test case for you, but I can provide some other information. It is RNA seq data and...
@cmnbroad And here is the output of BaseRecalibrator. [S3_2.unmapped.recal_data.csv.zip](https://github.com/broadinstitute/gatk/files/4262176/S3_2.unmapped.recal_data.csv.zip)
@cmnbroad Thanks, I didn't notice that. I will check and get back to you later.
The root cause might be irrelevant but I am still posting it in case someone is in a similar situation. I was running the GATK workflow https://github.com/gatk-workflows/gatk4-rnaseq-germline-snps-indels on a local...