Alex

Hi, I'm a long time user of your package and every once in a while, using it in my scripts, I feel an itch to somehow avoid that annoying 80...

As for now, I could find only per-user traffic summary. It would be nice to have overall server traffic summary (sent/recieved).

[Bug] Unable to rewind back more than 30s on live streams

4

**Checklist (Your issue will be automatically closed if you delete this part)** - [x] I make sure that there are no *existing issues* - open or closed - which I...

**Checklist (Your issue will be automatically closed if you delete this part)** - [x] I make sure that there are no *existing issues* - open or closed - which I...

### Have you read a contributing guide? - [x] I have read CONTRIBUTING.md - [x] I have searched the existing issues and didn't find any that were similar - [x]...

### Have you read a contributing guide? - [x] I have read CONTRIBUTING.md - [x] I have searched the existing issues and didn't find any that were similar - [x]...

Sometimes it is desired to notify users about server reboot, maintenance downtime etc. Wouldn't it be nice to have the ability to send notifications to all server(server+protocol) users. It may...

I stumbled upon this one, when I was trying to find out, how does your `pcr` kwarg work. Here how it was: ```py >>> seq = "ACGAGCGAGCGGAGCGGGCG" >>> import seqfold...

This PR introduces new tests, that target the bug, described in #17 (long description may be split between multiple lines) as well as the `write` function logic fix.

Example: ```julia julia> using FastaIO julia> long_header = join(fill("123456789_", 10)) "123456789_123456789_123456789_123456789_123456789_123456789_123456789_123456789_123456789_123456789_" ``` `writefasta` works as expected: ```julia julia> writefasta(stdout, [(long_header, "AGCT")]) ┌ Warning: description line longer than 80 characters (entry...