Lars Snipen

I installed krakenuniq by singularity, pulled the container from https://quay.io/organization/biocontainers. Latest Version is 0.5.7. It runs (krakenuniq-download produces help-text), but I cannot even download the taxonomy (Fetch failed). Is it...

Thanks for this. I did the batching myself, actually, and it works. The reason I did not think of this as a memory problem is that there was no "out...

SortMeRNA version 4.3.4 A singularity container from singularity.galaxyproject.org

No it looks fine, but do these alignments run across the end of the subject sequence? In my results the coordinates looks correct in all cases, except for those where...

OK, here is an example: The subject sequence is 404 bases long. There are 3 query sequences, all 150 bases long: a) The last 100 bases of read1 matches the...

OK, here is the output for read3: ``` Sequence ID: subject1 Query ID: read3 Score: 184 bits (158) Expect: 3.38e-43 strand: + Target: 305 AGGGGTAAAATCCGTAGAGATAACTAGGAATACCAAAAGCGAAGGCAATCTTCTGGAACA 364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Query: 1 AGGGGTAAAATCCGTAGAGATAACTAGGAATACCAAAAGCGAAGGCAATCTTCTGGAACA...

The next 8 bases in the Query are: CAAACAGG And the last 8 bases of the subject are: CAAACAGG These are not part of the alignment even if they are...

Yes, for this particular situation, and it is always exactly 8 bases short.

OK, thanks for this clarification. It means the alignment I get with sortmerna should not be thought of as the best possible, only "good enough" (small e-value).

Hmm, if you do a SW I think "best possible" is bound to be largest possible score. I cannot see how you can leave out exact-matching parts of the alignment...