parasail-python icon indicating copy to clipboard operation
parasail-python copied to clipboard

Python bindings for the parasail C library.

Results 26 parasail-python issues
Sort by recently updated
recently updated
newest added

Having difficulty with the pip installer on mac (10.13.6). following along in `setup.py`, it looks like it fails to find the parasail configuration script, prepends /usr/bin to the path... succeeds...

The readme mentions: > Be careful using the attributes of the Result object - especially on Result instances constructed on the fly. For example, calling parasail.sw_trace("asdf", "asdf", 11, 1, parasail.blosum62).cigar.seq...

I'm trying to align some palindrome sequences, and there is a weird behavior of cigar string. ```python import parasail def test(): a = 'AAAAGACTTGGCTCGACAACGC' b = 'GCGTTGTCGAGCCAAGTCTTTT' # reverse complement...

Hi, currently the tests for parasail-python segfault on arm64. I've no clue for the reason behind it. Please consider fixing it at the earliest. Log: ``` I: pybuild base:232: cd...

This is going to be a long post. I have included code details to replicate the problem, at the end. I'm using sg_trace_striped_16 on two nearly identical strings of length...

This seems relevant to issue 3, which is closed. Please see my comment there.

Hi Jeff, I'm posting this issue for a collaborator. We run into the error pasted below ``` Command "/anaconda3/bin/python -u -c "import setuptools, tokenize;__file__='/private/var/folders/x3/5tv3wm3n48q4ry3tct3mg3bw0000gn/T/pip-install- p6zwae25/parasail/setup.py';f=getattr(tokenize, 'open', open)(__file__);code=f.read().replace('\r\n', '\n');f.close();exec(compile(code, _file_, 'exec'))"...

A number of reported issues would have been avoided had there been an automated test suite with good code coverage on 32- and 64-bit Python2/3. @philres any suggestions? My Python...

I am trying to install parasail on my computer but it does not seem to work. I am using python 3.7 on Mac OS. with the following command: >> python3...

I tried aligning a 81kb sequence to a 101kb sequence with `nw_trace_scan_16` and the resulting CIGAR is just `1X`. If I repeat this with `nw_trace_scan_32`, it works fine. Is this...