Ian Fiddes
Ian Fiddes
I raised this issue on stackoverflow recently: https://stackoverflow.com/questions/59312056/using-luigi-localtarget-with-pdfpages-in-python3/60309832#60309832 Is it possible to allow for byte write mode for localTargets?
I tried aligning a 81kb sequence to a 101kb sequence with `nw_trace_scan_16` and the resulting CIGAR is just `1X`. If I repeat this with `nw_trace_scan_32`, it works fine. Is this...
There is plenty of [documentation](https://towardsdatascience.com/how-to-manage-conda-environments-on-an-apple-silicon-m1-mac-1e29cb3bad12) on how to use aliases to build conda environments on an M1 to be able to use x86-only tools. However, when I run `tox-conda` on...
I followed the guide to set up Alexa Switches in order to be able to turn on and off a set of dimmers. As far as I can tell, at...
Which is on github! I am not directly committing this because I was getting the weird error with the HMM I was getting the other day (despite submodules being updated)...
Replacing this with fixed integer values fixes the problem.
I am trying to modify miniver to not allow installations that do not properly resolve to a known version by raising an exception. I therefore modified all the places where...
GDB showed me I get a segmentation fault [here](https://github.com/soedinglab/MMseqs2/blob/master/src/util/convertalignments.cpp#L33C68-L33C88) ```#0 0x0000555555f577fe in printSeqBasedOnAln (out=..., seq=0x7ffff789709c "TATTTTATTTTGTGTAGAGATGGGGTCTCACTAGGTTGCC\n", offset=39, bt=..., reverse=false, isReverseStrand=true, translateSequence=, translateNucl=...) ``` With `offset = 39`, and `seqPos =...
Hello, I wanted to let you know I opened a PR to BioConda to put this package on it: https://github.com/bioconda/bioconda-recipes/pull/44008 I noticed that you only have the single 1.2.1 release...