Xi Chen

Ah, I see. I will have a look at MAESTRO to see how it is done. Yes, I personally think adding an extra column with cell barcodes to the TagAlign...

Thanks for the quick reply and tips. The fasta file is good with `hisat2` and `bowtie2`, so I thought it was okay. In addition, the `_alt` chromosomes in `GRCh38` sometimes...

Hmm ... I tried with the `gz` file, it was still not working. The error happens on our cluster, which uses `Red Hat Enterprise Server 7.5 (Maipo)` with `gcc v8.2.0`....

Thanks for the reply. On the cluster, I submit job with `bsub` and request 48G memory, which should be enough. I just found out that I can successfully build index...

Okay, done. Here are the two numbers for chr1-4: ``` len: 2097152 num bases: 879660065 ``` Here are the two numbers for all chromosomes: ``` len: 69810327 num bases: 3088286401...

Hi, just realised that I forgot to report back. Sorry!!! I think the problem is not in the reference file. There might be something wrong with my environment on the...

I have the exact same problem. Having searched a bit, I found the answer in [issue #295](https://github.com/matze/mtheme/issues/295). it seems a simple use of `{}` will do the trick. You just...

From an experimental point of view, the 5' end of the fragments is the main interest, so it is better to treat them as single end and perform peak calling...

Hi Philip, Thanks. First, note that the P5 always ends with `ACAC`. For TruSeq single, Read 1 is: `5'- TCTTTCCCTACACGACGCTCTTCCGATCT -3'` For TruSeq dual, Read 1 is: `5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'`,...

I see. That is strange, and I will leave this open to see if other people have some explanations.