Christiam Camacho

Results 16 comments of Christiam Camacho

FWIW the suggestion in this comment can be used as a workaround: https://github.com/sphinx-doc/sphinx/issues/4054#issuecomment-329097229 I hope this helps!

I hereby give my explicit permission to switch to the BSD 3-clause license.

@elasekness , have you tried setting the cluster name configuration setting: https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/configuration.html#cluster-name ?

@nathanweeks , can you use the 2.15.0 docker image in https://hub.docker.com/r/ncbi/blast/tags ?

Yes, we'll update the docker images in the next month. I'm sorry for the inconvenience.

@nathanweeks , the docker.io/ncbi/blast-static:2.15.0 image has been updated.

> I can't see why the google-cloud-sdk is in the container. `gsutil` is needed in when downloading BLAST databases from GCP whenever Requester Pays is enabled on a bucket. In...

I fixed the TOC as best as I could (it seems to be hand-edited these days) and added specific steps to follow from the article on how to report BLAST+.

Hi @khyox , Does the addition of the `-target_only` command line option address your needs? ``` $ blastdbcmd -db nt -entry X57170.1 -target_only >X57170.1 B.taurus 5S rRNA gene GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGGGTCGGGCCTGGTTAGTACTT GGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT...

@khyox , a possible workaround would be to extract all the sequence IDs from nt, then extract the FASTA for each sequence using the the `-target_only` command line option. An...