aushev
aushev
HaplotypeCaller checks for `samplesList.numberOfSamples() != 1`. The idea was probably about detecting cases with `> 1`, but when no `@RG` present in the BAM file (i.e. `== 0`), it throws...
Example query here: [overpass-turbo.eu/s/1DQd](https://overpass-turbo.eu/s/1DQd) ``` [out:csv(::id,::type,::lat,::lon, name; true; ",")]; way[name ~ ' Trial'](48.71,-120.9,55.16,-110.4); out; ``` When object `name` contains " Error" string (like this [way 353969638](https://www.openstreetmap.org/way/353969638)), it raises Query Error:...
Here is example table: ``` r dt1
Example of code to reproduce: ``` R dt1
Trying to run FastQC for my bz2-compressed file `fastqc 08asp.fastq.bz2` - I get the following error: > Started analysis of 08asp.fastq.bz2 > Failed to process file 08asp.fastq.bz2 > uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Ran...
I think it's a bit confusing that many sequences in the list are duplicated, for example `AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA` is listed 5 times, with different names: - Illumina DpnII expression PCR Primer...
I have an impression that sequences of the Illumina TruSeq adaptors starting from Index 13 are wrong. I checked in couple sources, including [Illumina website](https://support.illumina.com/downloads/illumina-adapter-sequences-document-1000000002694.html), and starting from Index 13...
When I try to take color from numeric variable and one of the axes is factor, it raises error `Error in Summary.factor(...) : ‘range’ not meaningful for factors`: ```r data(mpg)...
**Describe the bug** When text in the cell contains escaped characters written like `'`, `&` etc - some of them are converted (`<` becomes `