Amina Kurbidaeva

awk: cmd. line:1: fatal: division by zero attempted

9

I tried running MUM&Co on several query-reference pairs. In several occasions, I got the error: > Matching query and reference chromosomes > > awk: cmd. line:1: fatal: division by zero...

conda/mamba installation not working with python=3.11

3

I tried to install hicexplorer inside a Singularity container with conda, and it didn't work due to incompatibility: ``` Collecting package metadata (current_repodata.json): done Solving environment: unsuccessful initial attempt using...

hicPlotTADs error: bw file not displayed

2

I am using hicPlotTADs to simultaneously visualize hic map and chromatin marks tracks. My tracks.ini file: ``` [bigwig] file = PRO-seq.bw title = PRO-seq color = black min_value = 0...

HicPlotTADs Hi-C contacts not being plotted

2

I am trying to plot TADs I called on a Hi-C matrix with resolution 1kb. But no contacts are being plotted on the map. This is my command: `hicPlotTADs --tracks...

HiCFindTADs ran successfully on .cool file, but two files were missing from the output: output_score.npz output_zscore_matrix.h5 Is that normal? Other output files look ok.

I could not find it in the Documentation. Could you please point me to an API that would perform similarly to computeMatrix + plotProfile? [(https://deeptools.readthedocs.io/en/develop/content/tools/plotProfile.html)](url)

Calulate_map_resolution.sh issue

7

I am having an issue similar to #213 which wasn't resolved. I tried to use a nodups.pairs file generated with _pairtools_ to run calculate_map_resolution.sh. I had the following output: ```...

Creating gene annotation from GFF file fails

1

I am trying to create gene annotations file from GFF following this protocol: https://github.com/higlass/gene_annotations Receive an error: ``` Processing line #: 0 Traceback (most recent call last): File "scripts/gff_to_jsonl.py", line...

Ragout is incompatible with Python 3.10

1

Are there any updates coming? Ragout is incompatible with Python 3.10. Specifically, Python 3.10 does not have Mapping class in the collections module.

HMM file format error when using custom library in FASTA format

1

I am trying to run RepeatMasker with a custom library downloaded from a database. It's in fasta format: ``` >ORSgTETNOOT01930 gi|14578149|nt85894-86033 unclassified transposon GGCTGCGTTTAGATCCAAAGTTTGGATCCAAACTTCAGTCCTTTTCCATCACATCAACCT GTCATACACATAAAACTTTTCAGTCACATCATCTTTAATTTCAACCAAAATCCAAACTTT GCGCTGAACTAAACACAGAC >ORSgCMCM00201320 gi|28460675|nt108249-108396 putative centromere...