Koen-vdl

Results 12 comments of Koen-vdl

Rolling back `vt `to an older version also did it for me. `conda create -n snippy_env snippy vt=0.57721`

> Hi @vfonti > I was having the same error message. > I was able to download all the files manually by right-clicking on the hyperlink, saving the link location,...

had the same issue: used this workaround ``` #create krona_env with krona conda create -n krona_env krona -y conda activate krona_env # delete a symbolic link that is not correct...

I tried doing the exact same thing with ONT reads just now. A `minimap2 `based amplicon read-splitter would be lightning fast. `minimap2 -t 64 -x map-ont primers.fasta ONT.fastq.gz` Unfortunately, I...

Still no hits with: `minimap2 -c -x map-ont -t 60 -k 11 -w 5 primers.fasta barcode91_ITS2.fastq.gz` I uploaded the input files in case you wish to take a look @lh3:...

Hi @JDavidson2019, Unfortunately, I did not find a fix. As a (slow) workaround, I'm currently using the following `seqkit `approach: ``` seqkit fish --threads $threads -q 20 -F ATGCTTAAATTTAGGGGGTAGTC input.fastq.gz...

Yes, my OS is Ubuntu 20.04.6 LTS server

I experienced the same issue. As @amandawarr suggests, the pipeline can be fixed by editing the 235'th line of LILO: `source $CONDA_PREFIX/etc/profile.d/conda.sh` and replacing it with your conda `base `activator...

This remains an issue in 2024. Would be great to see Kampong Cham Province and Tboung Khmum Province corrected. If it helps: Tboung Khmum province was established by Royal Decree...

Thanks for getting back so quickly to me @nickjcroucher. I added `--model GTR` and obtained the same result. As you suggested `*.tre.rooted` indeed contains a lot of near zero branch...