vg icon indicating copy to clipboard operation
vg copied to clipboard

How to genotype overlapping variants

Open jinshangkun opened this issue 3 years ago • 0 comments

1. What were you trying to do? I am trying to use giraffe to genotype structural variants.

2. What did you want to happen?

3. What actually happened? The number of structural variants in the output of vg call is less than the original number of structural variants. And then I found that variants with overlapping positions cannot be genotyped. For example: The original VCF (used to construct Pan genome): A02 4271 INV22442 A <INV> . PASS SVLEN=16989;SVTYPE=INV;END=21260 GT 1/1 A02 11099 DEL230159 ATCTCTCTCGCTCTCTTTTCAAATTTTTGCTTTCATTCTTTTTTACCTTCGTGTTACCAGAGGCCAAACAAACATCCCCCATTTGTTTCTCGATTC A . PASS SVLEN=-95;SVTYPE=DEL;END=11194 GT 1/1 A02 38065 DEL697604 TAAGAATCAATATAACATATCTGACACTTGCTTGCAGTAAATATACAATCACCATTAA T . PASS SVLEN=-57;SVTYPE=DEL;END=38122 GT 1/1 The output of vg call: A02 4271 135_671 21.4502 PASS DP=6 GT:DP:AD:GL:GQ:GP:XD:MAD 0/0:6:5,0,0,0,0,0:-4.233340,-5.688827,-5.688827,-5.688827,-5.688827,-5.688827,-8.123975,-8.123975,-8.123975,-8.123975,-8.939764,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975,-8.123975:0:0.000000:13.099421:5 A02 38065 1196_1199 342.677 PASS DP=13 GT:DP:AD:GL:GQ:GP:XD:MAD 1/1:13:1,12:-37.431422,-4.095620,-3.828483:2:-1.530774:17.979057:12

Thus, the variants named DEL230159 was lost.

How to resolve it? Many thanks for any solutions!

4. If you got a line like Stack trace path: /somewhere/on/your/computer/stacktrace.txt, please copy-paste the contents of that file here:

Place stacktrace here.

5. What data and command can the vg dev team use to make the problem happen? vg autoindex --workflow giraffe --prefix Gh -R XG --ref-fasta $ref --vcf $vcf -t 10 -T ./ vg giraffe -x $output/Gh.xg -H $output/Gh.giraffe.gbwt -g $output/Gh.gg -m $output/Gh.min -d $output/Gh.dist -f $input/D1_1.fq.gz -f $input/D1_2.fq.gz -t 30 -p 2>$output/log.txt >$output/D1.gam vg pack -t 30 -Q 5 -x $output/Gh.xg -g $output/D1.gam -o $output/D1.pack vg call -t 30 -k $output/D1.pack $output/Gh.xg > $output/D1.vcf

6. What does running vg version say?

vg: variation graph tool, version v1.32.0 "Sedlo"

jinshangkun avatar May 04 '22 08:05 jinshangkun