fetching sequence failed, FASTA read interval was out of bounds

[TKsh6]

I also met this problem, when I ran this comman, modkit pileup --ref /mnt/raid/syl/5mc/05_20250122/5_remora/4_remora_inference/4mer.fasta --cpg --ignore h --combine-strands 4mer.infer.sort.bam 4mer.infer.bed

> fetching sequence failed, FASTA read interval was out of bounds
> fetching sequence failed, FASTA read interval was out of bounds
> fetching sequence failed, FASTA read interval was out of bounds
> fetching sequence failed, FASTA read interval was out of bounds
...

But the reference is the one that was used for bonito basecaller here is my bam,

fd69d0df-b9e0-4d5c-9e38-43f6f727f245    0       4-Mer   22      60      2S4M1D3M2D34M4I97M3D5M1D51M1D59M2I15M3D14M1D16M7S       *       0       0       TTCTGAACCTTTTTTTTGACGAAAACGTTTTGTTGAACTTCACCGATGGTTAA>
fd6f8789-7bcd-4c66-ae93-328fe707dfb0    16      4-Mer   7       60      23M1D30M1D20M1I19M4D22M1I7M1I12M1I1M1I78M1I27M2D6M1D16M2D10M1I3M1I7M2I35M265S   *       0       0       GAAAGCTGCGTAATCCTGAGACCTTTTTT>
fdd5590f-b5f7-4241-8789-7a1df3b7b176    0       4-Mer   33      60      24M1I9M1I17M2D14M2D37M2I14M2I52M1I30M1I30M3I32M3I2M3D20M        *       0       0       TTTTTTTGACGAAAACGTTTTGTTCGAACTTTACAGGCTAACAAC>
fdf13d4b-fbe1-4780-81c7-3623eb486f57    16      4-Mer   6       60      10M1I10M3D37M1D6M3I6M2D68M1D52M1D2M1I32M2D9M1I4M1I37M 

my reference is the 4mer.fasta, and its .fai is also here. So how can I do to solve this problem?

[ArtRand]

Hello @TKsh6,

Sorry about the error. Could you send me a small modBAM that reproduces the problem? It would also help if you could run the command with --log-filepath and send me the debug log. I'm not familiar with 4mer.fasta could you tell me where I can get that as well? You can either attach the files to this thread or email them to me at art.rand[at]nanoporetech.com.