Unexpected behavior when a Sequence object is returned from a function
Hello!
I made a trivial function that returns a sequence from a Fasta class expecting it to return an object of the Sequence class.
However, it returns meaningless and different characters every time the script is run.
On the contrary, if I don't use the function, but extract the gene in the main routine, I can handle the Sequence class object as expected.
Is this behavior to be expected or is it a bug?
For the test I used this file https://github.com/lmdu/pyfastx/blob/master/tests/data/test.fa
Here is the script:
import pyfastx
import sys
def extract_gene(file, gene):
fasta = pyfastx.Fasta(file)
return fasta[gene]
if __name__ == '__main__':
print(f'Python version: {sys.version}')
print(f'pyfastx version: {pyfastx.version()}\n')
print('Extracting in __main__\n')
fasta = pyfastx.Fasta('test.fa')
gene = fasta['JZ822577.1']
print(gene)
print('\n\nExtracting in extract_gene function\n')
gene = extract_gene('test.fa', 'JZ822577.1')
print(gene)
output is as follows:
Python version: 3.9.1 | packaged by conda-forge | (default, Jan 26 2021, 01:34:10)
[GCC 9.3.0]
pyfastx version: 0.8.4
Extracting in __main__
CTCTAGAGATTACTTCTTCACATTCCAGATCACTCAGGCTCTTTGTCATTTTAGTTTGACTAGGATATCGAGTATTCAAGCTCATCGCTTTTGGTAATCTTTGCGGTGCATGCCTTTGCATGCTGTATTGCTGCTTCATCATCCCCTTTGACTTGTGTGGCGGTGGCAAGACATCCGAAGAGTTAAGCGATGCTTGTCTAGTCAATTTCCCCATGTACAGAATCATTGTTGTCAATTGGTTGTTTCCTTGATGGTGAAGGGGCTTCAATACATGAGTTCCAAACTAACATTTCTTGACTAACACTTGAGGAAGAAGGACAAGGGTCCCCATGT
Extracting in extract_gene function
@B5��@B5��� ��U� ��U@B5�
Thank you for reporting this issue. This bug was caused by the destroyed index. When the function 'extract_gene' finishes running, the generated Fasta object will be destroyed immediately due to no reference to it, because fasta object created within function is a local variable. Meanwhile, the index will also be destroyed with Fasta object. So, if we use sequence object with the broken index, it will cause a critical error.
Thanks again! I will fix it in next few days.
We have fixed this issue in new versions >= 0.9.0