Circle-Map icon indicating copy to clipboard operation
Circle-Map copied to clipboard

An error happenend during execution. Exiting

Open johnstonmj opened this issue 5 years ago • 9 comments

Hi Inigo,

I have multiple samples where Circle-Map will fail with: "An error happenend during execution. Exiting"

stderr:

[E::idx_find_and_load] Could not retrieve index file for 'output/circle-map/namesort_bams/tissue1.namesort.bam'
  0%|          | 0/800 [00:00<?, ?it/s]
0it [00:00, ?it/s][A
  0%|          | 1/800 [00:14<3:17:10, 14.81s/it]
  0%|          | 1/800 [00:14<3:18:24, 14.90s/it]
0it [00:14, ?it/s]

stdout:

2020-10-13 14:06:35: Realigning reads using Circle-Map

2020-10-13 14:06:35: Clustering structural variant reads

2020-10-13 14:25:21: Splitting clusters to to processors

2020-10-13 14:25:38: An error happenend during execution. Exiting
  1. Perhaps this is shared with Issue #35 ? However, the speed isn't my issue, but rather the early exit / run failure. One of my samples exits very quickly, so maybe I'll be able to debug with that sample as my test case. I'll let you know if I have any luck.

  2. When this error occurs, could the call to sys.exit() be modified to return exit code 1? Or any non-zero value? With the default return status of 0, wrapper job scripts around Circle-Map will not be able to detect that an error has occurred.

johnstonmj avatar Oct 13 '20 22:10 johnstonmj

I ran into the same problem of early exiting.

jinyung avatar Oct 20 '20 02:10 jinyung

Hi Inigo,

I've done a bit of digging into my failing samples.

When I re-run Circlemap-Realign interactively, I get additional warning messages that were not captured in the stdout / stderr when the same commands were submitted as a batch job. These warnings are similar to those encountered in #46 .

[E::idx_find_and_load] Could not retrieve index file for 'output/circle-map/namesort_bams/tissue1.namesort.bam'
  0%|             Traceback (most recent call last):                                                      | 0/800 [00:00<?, ?it/s]
  File "/home/michael/.snakemake/conda/68e54810/lib/python3.8/site-packages/circlemap/realigner.py", line 305, in realign
    prob = realignment_probability(realignment_dict,interval_length)
  File "/home/michael/.snakemake/conda/68e54810/lib/python3.8/site-packages/circlemap/utils.py", line 1111, in realignment_probability
    posterior = 2**best_hit/(np.sum((2**value[2]) for key,value in hit_dict['alignments'].items()))
ZeroDivisionError: float division by zero
/home/michael/.snakemake/conda/68e54810/lib/python3.8/site-packages/circlemap/realigner.py:389: UserWarning: Failed on interval chrom        chr3
start    93470357
end      93470657
Name: 0, dtype: object due to the error float division by zero
  warnings.warn(
  0%|                                                                                           | 1/800 [00:11<2:38:47, 11.92s/it]
2020-10-20 20:58:02: An error happenend during execution. Exiting
0it [00:11, ?it/s]

For context, this region of hg38 chr3:93470357-93470657 is:

  • Very high coverage, spanning repetitive sequence
  • Spans the right edge of pericentromeric NNNNs in the chr3 sequence.

The error indicates that utils.py, line 1111: realignment_probability divides with a denominator of zero.

I'm not sure how the denominator of posterior = 2**best_hit/(np.sum((2**value[2]) for key,value in hit_dict['alignments'].items())) evaluates to zero.

If realignment_dict does not exist, this should be caught by the preceding realignment_dict == None. Is it possible to have large negative values (e.g. value[2] = -10000)? If so, this could lead to:

>>> 2**-10000
0.0

As realignment_probability() is only used to trigger if-else conditions for read re-alignment (bam2bam.py, line 263; realigner.py, line 305), could a try-except be added such that if divide-by-zero occurs, realignment_probability() simply returns zero? This would result in a 'pass' for any failing reads, allowing Circle-Map Realign to continue.

I've edited utils.py such that:

def realignment_probability(hit_dict,interval_length):
    """Function that takes as input the realignment dictionary and returns the alignment probability of the best hit"""


    best_hit = hit_dict['alignments'][1][2]

    #this might be included on the denominator

    try:
        posterior = 2**best_hit/(np.sum((2**value[2]) for key,value in hit_dict['alignments'].items()))
    except ZeroDivisionError:
        posterior = 0

    return(posterior)

And now my sample is running beyond the point where it previously failed.

johnstonmj avatar Oct 21 '20 17:10 johnstonmj

Hi Michael,

This sounds great. I have been on vacation and I will start to look at the pile of issues tomorrow. By the way, I really appreciate your effort!

iprada avatar Oct 21 '20 17:10 iprada

Hi Inigo,

I hope you enjoyed your vacation!

I believe I have found another source of ZeroDivisionError that leads to this error. I mention the ZeroDivisionError in realignment_probability() above. I also encounter ZeroDivisionError in pssm() in a small subset of samples in regions where a 300 bp window in the genome is lacking certain nucleotide.

Error message:

realigner.py, line 295 realignment_dict = realign(read,self.n_hits,plus_coding_interval,minus_coding_interval,
    plus_base_freqs,minus_base_freqs,self.gap_open,self.gap_ext,self.verbose,edits_allowed)

Points to: utils.py, line 962, within realign()score = pssm(phred_to_prob(np.array(soft_clipped_read['qual'],dtype=np.float64)), encoded_nucs, edlib_cigar_to_iterable(alignment['cigar']), plus_base_freqs,gap_open,gap_extend,nuc_and_ops,verbose)

And finally: ZeroDivisionError: division by zero

The pssm() function in utils divides by base frequencies.

This is the reference sequence of the interval that was being analysed when the run failed:

>chrUn_KN707709v1_decoy:1-300
CACACGCACACAGAGACACACGCACACAGAGACACACGCACACAGAGACACACGCACACA
GAGACACGCAGAGAGAGACACGCACAGAGAGACACGCACAGAGAGACACGCACACAGAGA
GACACGCACACAGAGAGACACGCACACAGAGAGACACGCACACAGAGAGACACGCACACA
GAGAGACACGCACACACGCACAGAGAGACACACAGACACAGAGACAGAGAGAGACAGAGA
GAGAGACACAGAGAGACAGAGAGAGAGACACAGAGACAGAGACACAGAGACAGAGAGAGA

In another sample that fails, the sequence is:

>chrUn_KN707709v1_decoy:1200-1500
AGAGAGAGAGACACACACGGAGAGAGAGAGAGACACACACGGAGAGAGAGAGAGAGACAC
ACGGAGAGAGAGAGAGAGAGACACGGAGAGAGAGAGAGAGACACGGAGAGAGAGAGACAC
ACGGAGAGAGAGAGAGAGACACACGGAGAGAGAGAGACACACGGAGAGAGAGAGACACAC
GGAGAGAGAGAGACACACGGAGAGAGAGAGAGAGACACGGAGAGAGAGAGAGAGACACAC
GGAGAGAGAGAGAGAGACACGGAGAGAGAGAGAGAGAGACACACGGAGAGAGAGAGAGAG

My bet is the lack of T causes base_freq of T to be 0, and division by zero. Can additional try-except be added to account for this possibility?

Or, if it doesn't break the base frequency math / logic, could a minimum base_freq be set to a low non-zero value, simply to avoid the ZeroDivisionError? Something like: base_freq = max(base_freq, 0.001)

johnstonmj avatar Oct 26 '20 15:10 johnstonmj

Hi Inigo,

Regarding the second source of ZeroDivisionError:

The function background_freqs() is indirectly used to calculate a division denominator within pssm().

My fix was to edit utils.py such that:

def background_freqs(seq):
    """Function that takes as input the sequence of the nucletide frequencies in the realignment interval"""

    # return{nucleotide: seq.count(nucleotide)/len(seq) for nucleotide in 'ATCG'}
    return{nucleotide: max(1,seq.count(nucleotide))/len(seq) for nucleotide in 'ATCG'}

This forces the value to be at least 1, which still results in a very low base_freq within pssm() but at least it is non-zero.

The samples that previously failed are now succeeding.

johnstonmj avatar Nov 05 '20 15:11 johnstonmj

Dear Jon,

sorry for the late reply. I am incredibly busy.

First of all, thanks a lot for taking care of this issues. It would have take me a lot of time to figure out what was going on. Would you up to put this into a pull-request?

On another note: Could you contact me by email? I tried looking for your mail but did not manage to find you.

Best,

Inigo

iprada avatar Nov 05 '20 16:11 iprada

I was already considering making the pull request, but I hadn't found the time. I'll see if I can get to it soon!

And yes, just e-mailed you separately.

Cheers, Michael

johnstonmj avatar Nov 05 '20 16:11 johnstonmj

I just pushed a patch that fixes the ZeroDivisionError of the realignment probability.

Thanks a lot for your help John. I am currently testing it and it seems to work. If it works, I will submit it to bioconda and do a proper release

iprada avatar Mar 10 '21 15:03 iprada

Hi Inigo, I'm still running into the same error, do you mind telling me how you fixed the error? Thanks.

Best, Robin

zhuyiqin avatar Nov 23 '22 01:11 zhuyiqin