Interpretation on <output_prefix>.tsv

[HLHsieh]

Hi there,

I've received an output file, and according to the readme, the allele column should indicate the allele to which the support read is assigned, based on the genotype results. I'm puzzled as to why it's displaying NA instead of 34.5, and why it does not consider 349.2 as the second allele.

chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	40b2e343-cc45-4c7c-9714-bede62e39748	CCCGTGAGCCCCCCACCACTCCCTC,CCCGTGAGCCCCCCACCACTCCCTCCCCGTGAGCCCCCACACCCTC	34.0	850	15218	-	34.5	full
chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	9fef502d-c95e-47e6-b8e7-7e3f3de33850	GCCCCCACCACTCCCTCCCCGTGA	34.0	849	7101	+	34.5	full
chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	4a03adc1-1d6a-4efe-a38d-fb5fa7a12581	TGAGCCCCCACCACTCCCTCCCCG	34.0	849	744	+	34.5	full
chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	43170596-da45-4fd9-b4a0-a26c934cf4c3	CCTCCCCGTGAGCCCCCACCACTC	32.4	810	480	+	34.5	full
chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	8ed4d156-5898-46a9-b4a2-12c9be80944f	CCCCGTGAGCCCCCACCACTCCCT	32.2	804	2157	+	34.5	full
chr19	1049437	1050023	CCCCGTGAGCCCCCCACCACTCCCT	chr19:1049437-1050023	15	34.5(13)	37df087b-09e5-4b7c-bf5e-452310692056	CCCCGTGGGCCCCCCACCACTCCCT	349.2	8730	2280	+	NA	full

Any comment would be appreciated.

Best, Hsin

[readmanchiu]

Hi @HLHsieh,

The reason is 349.2 has only 1 support read, you need at least 2 to confirm the allele.

Thanks for using Straglr