FusionDirect.jl icon indicating copy to clipboard operation
FusionDirect.jl copied to clipboard
verified publisher icon OpenGene

* symbol between fusion sequence

Open foxchase opened this issue 7 years ago • 0 comments

Hello, is it possible to have a symbol such as "" between two sequences merged together? Below is an example; AACAACGGGAAGAGGGCAAAGTGAAGCAGCCACAGGAAGAGGACTGGACGCCCCAGACCCGGGCCTCCTGAGCTACACTGACAAGCTGTGTTCCCAGAAA

Thanks.

foxchase avatar Jun 07 '18 14:06 foxchase