MVesuviusC
On the construction of Mammmal 16S primer tree
Hi,
I am currently learning to use the PrimerTree software package developed by your team. When I constructed a phylogenetic tree of 16S mammal primes with the following script, the results were inconsistent with the literature. I would like to ask if you know what went wrong, or can you send me a 16S mammal tree correct script?
>library(primerTree)
>mammals_16S = search_primer_pair(name='Mammals 16S',
'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT', num_aligns=2000, total_primer_specificity_mismatch=3)
mammals_16S_filtered <- filter_seqs(mammals_16S, min_length=131, max_length= 156) plot(mammals_16S_filtered, ranks='class', size =1, guide_size = NULL) plot(mammals_16S_filtered, ranks='order', size =1, guide_size = NULL)
Warm regards,
Min Hui
Hey Min Hui, your tree will likely look slightly different as the blast database is frequently updated. So long as your tree looks somewhat similar I think you're good.
Hello Matt，thank you for your reply. If the Mammal 16S primer tree is different due to the blast database update, should the number of class results increase? However, as a result, my primer tree reduced two classes of Amphibia and Actinopteri. I don't know what caused this. Is it because 'num_aligns=2000' is too little, so how much is set when you set this parameter?
I imagine it all depends on what's been added to the database. 2000 is a good starting point, though more is better. At some point you're going to run into computational limits or just limits in how long you're willing to wait to get results. If you bump up your numbers make sure you're using a blast api key to speed things up.
Hello Matt，I increased the number of points as you suggested in an attempt to reach a higher number of classes for the 16S mammalian primers. This time I used 'num_aligns=5000', which seemed fine at first, but at the end of the current run I was about to output the primers tree using 'plot_tree' and there was an 'Error: node stack overflow 'error message, as shown below. Do you know how to solve this problem?
........ 5000 sequences retrieved from NCBI in 3092 seconds, product length min:1 mean:132.05 max:138 5000 sequences aligned in 94 seconds length:149 pairwise DNA distances calculated in 3 seconds constructed neighbor joining tree in 149 seconds
mammals_16S_filtered <- filter_seqs(mammals_16S, min_length=131, max_length= 156) 1187 sequences below 131 0 sequences above 156 plot(mammals_16S_filtered, ranks='class', size =1, guide_size = NULL, legend_cutoff = 25) Error: node stack overflow